Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB58YE10FM1
Length(NT) : 624
Best Gene Model Blast : Link to GSTUMT00005179001 E-value : 9e-92
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein MGG_08834
Accession: ref|XP_363989.1| Score: 190 E_value: 1e-22
KEGG Definition: hypothetical protein; K02903 large subunit ribosomal protein L28e
Accession: mgr:MGG_08834 Score: 190 E_value: 6e-23
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG3412 Score: 163 E_value: 2e-12
PFAM Definition: Ribosomal_L28e, Ribosomal L28e protein family..
Pfam Number: pfam01778 Score: 179 E_value: 2e-14
Swissprot: O14069|RL28E_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol

Sequence:
>SY0AAB58YE10FM1
TTGGACAGAGCCTGCTTCGGCCGCATGAACGCCTAACCGACGAATATCTA
GAACCCCCGGGTAGGCTCTTGACACCCTTTTTTCTTTTTCCCCCAATAGC
TTCGCATCTTTGTGCTGTAATTTTTGGTTCCGACAATTTTCCCACTCGCA
ACCTCATCCTCAATTATGTCCTCAAATGTCAGCTCCGATCTCATCTGGGC
CATCACCAGGAATAATTCGTCTTATATTGTCAAGCGTGGACCTGTCAAAG
ACCAGATAATCTTCACCAGGGAGCCTCTGAGTCTCACTAACCAGCACACA
CGCAAGCACTCTGGACTTGTGAACGAGAAGGTCCAACCCGACTGCTATAA
CCCGTTTCTCAAATTCACGAATTGACTTGACGATTCTTACAGGCCGTTGG
TGTTCAAGCTGGAGAGAATGGAAATGTTGTTTTAATTACGAAGAAGAATG
CTGAGAAGCATGGAGACAAGCCCGCCTCCCTATACAACAAGACTACCTTC
CGCAAGTACAAGAGCAACCGCAAGATCTACTCTGCTATTGCCAATGCCGT
TGCCAAGAAGTCTTACCGATCTGACCTTCGCCAGGCCGCTGTTGCCCGTG
CTAGCGCCATCAAGAGATCGCAGA

Sequences in the Contig:

SY0AAB58YE10FM1