Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB58YE09FM1
Length(NT) : 622
Best Gene Model Blast : Link to GSTUMT00010937001 E-value : 5e-93
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001271443.1| Score: 131 E_value: 2e-14
KEGG Definition: hypothetical protein
Accession: fgr:FG03525.1 Score: 127 E_value: 5e-14
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB58YE09FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCTCGGCCTTTTTTTCTTCTT
TTCTATCTTGCTGCCTGTAATACTGAAGTGCAAGACAGTGGGTATAAGAT
TTTTTTCCTTCCCTTCTCCCCATTTTCTTGCTAGGAATCGAGAGATCCCA
TACACCCTGCTACAAACACAACCGTCGAATACAAACCCACGCTCTCTCCT
GCGACAACATTGAGGGACAAACAAGAATACCAGAAACTAGGAAGGGAGGA
AGGAAAATAGATAATAAATACTATCCCCCATGCACGAAGACGAAGGATAC
AGTTATTCCGAAGAGGAGGAGGAAGTAGAATATTCTCCGGATGAAGAACC
TTCATCCCAGGAGGAGTATGATGACAATCTCTCCACAATGTCCCTTTCAG
ATTCAATAACGGATTATGTGTATGAGAATGGTCGACGGTACCATTCATAT
CGTCAGGGGAGCTATGTTAGTAACTAATTACGAACAATTGGAGAATCTAA
TGCTAATGATGGGGTAGGTATTCCCTAATGACGAGCTAGAACAAGAGCGA
TTAGACCTAATGCACCACCTCTGGAGATTGGTTCTGGGTGGAAGATTATA
CTCCGTTCCGATAGTTGAGAGT

Sequences in the Contig:

SY0AAB58YE09FM1