Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB58YC24FM1
Length(NT) : 630
Best Gene Model Blast : Link to GSTUMT00006597001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein An12g06340
Accession: ref|XP_001395694.1| Score: 221 E_value: 1e-16
KEGG Definition: hypothetical protein
Accession: ang:An12g06340 Score: 221 E_value: 6e-17
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB58YC24FM1
TACTTGCCGAGCCGACAATTCACGGGAAAAGACAAGTACTTGATAGGATA
ACCAATGGCCGTGGTTTAGAGGATGCATACAGCACCACGTTGGAGCGGAT
AAGGCAACAGGGCGGAAGTAAAGCTAGGCTGGGAATGGAGGCGCTGATGT
GGATTTGTCATTGCGAGCGGCCCTTGAGCCCAGATGAGTTATGCCATGCG
CTGGGCGTGGAATTGGGGACTGAAGACTTTATCGTGGATAATGTCCCCTG
GTTCCAGGCCGTACTAGGCTGCACCTTAGGACTTGTTACAGTAGGGGAGG
GGGATTCAACGGTCCGTCTCCTGCATCTCACACTTCAGGAGTATCTTGGA
GAACATCCCACGTTATTTCCAACAGCCCACTCGATGATGGCCGAGGTCTG
CCTGACCTATGTAAATAGTTGGTTCATCCGCACATTGGATGTAGGTCCCG
ACGCAGCCCTAATAAGAGCACCGTTTCTTAGATACGCTACATGTTCCTGG
GCAACCCACACATCTACAAAGGTGACTGAAACCTTAAAGCTATTGGCATT
ACGACTTCTTGACGGATACGAGAACCATTTATCTGCTACTATTCTCTGGC
GAAAGATGATCCGCAAATATAGCTTTGTGG

Sequences in the Contig:

SY0AAB58YC24FM1