Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB58YC20FM1
Length(NT) : 347
Best Gene Model Blast : Link to GSTUMT00008773001 E-value : 1e-120
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_04443
Accession: ref|XP_001794861.1| Score: 166 E_value: 1e-10
KEGG Definition: hypothetical protein
Accession: ncr:NCU09250.1 Score: 162 E_value: 2e-10
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG4148 Score: 112 E_value: 5e-07
PFAM Definition: UPF0287, Uncharacterised protein family (UPF0287). This is a family of uncharacterised proteins..
Pfam Number: pfam08583 Score: 231 E_value: 7e-21

Sequence:
>SY0AAB58YC20FM1
TTGGCCGCAATGCATCCACACTTGAACAGAACCGACAGCGAGGAGGAATG
CCACGCCCGCGGATTCATGTGGAAGGCCATTGGGATGTGCAATGGGGCAA
AACATAATTTGAATATGTGTTTGCGGGCTGAGAGGCTTGAGCGGACCAAG
AAGAATAGGGAGGCGGCAAAGGATAAGAAGAAAGAGATTGTGCAGAAGTG
GGCTGAGATTGAGGCGAATTCATGATGGTGGGGGGCATTACAGTGGGAAG
GGAGTTGAGTTGGAGTTGGAGTTTTTTTCCATGCGAGAATGTAGCTGCAT
CGCATACTATCGCAAACGGCAATGGGGGGTATCTGTTCTCCCTCCTC

Sequences in the Contig:

SY0AAB58YC20FM1