Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB58YB15FM1
Length(NT) : 643
Best Gene Model Blast : Link to GSTUMT00001701001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein NCU00649
Accession: ref|XP_965789.1| Score: 410 E_value: 2e-45
KEGG Definition: hypothetical protein
Accession: ncr:NCU00649.1 Score: 410 E_value: 8e-46
KOG Definition:
Classification: [Coenzyme transport and metabolism].
Kog Number: KOG2511 Score: 281 E_value: 4e-26
PFAM Definition: NAPRTase, Nicotinate phosphoribosyltransferase (NAPRTase) family. Nicotinate phosphoribosyltransferase (EC:2.4.2.11) is the rate limiting enzyme that catalyses the first reaction in the NAD salvage synthesis. This family also includes Pre-B cell enhancing factor that is a cytokine. This family is related to Quinolinate phosphoribosyltransferase pfam01729..
Pfam Number: pfam04095 Score: 289 E_value: 5e-27
Swissprot: P39683|NPT1_YEAST
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0004516 = Molecular function: nicotinate phosphoribosyltransferase activity
GO:0005515 = Molecular function: protein binding
GO:0000183 = Biological process: chromatin silencing at rDNA
GO:0006348 = Biological process: chromatin silencing at telomere
GO:0019358 = Biological process: nicotinate nucleotide salvage
GO:0001302 = Biological process: replicative cell aging

Sequence:
>SY0AAB58YB15FM1
TTGGGGAGTTCTCTCAATTGCGCTTACGGACACTTTTGGTACCCCACACT
TCCTGAGAAACTTTGCCTTGAAATATCCTCCATCCGGCAGGTCCTACGCT
GAGGTATTCGCAGGAGTCCGTCAGGACTCTGGTGACCCAGAGGAATTTGT
CAAGCGTATGCGCAAGTTCTATGATGAGCAAGGGATTAAGTCGAAGAAAG
TGGTTGTGTTCTCAGACAGTCTGGACGTTGACCTCTGCCTAAAGTATAAG
GAGTTCGCTGAGAGGGAAGGTTTTATGCCTAGCTTTGGCGTTGGAACTTT
TCTGACAAACGACTTTGTGCACTTGAGTAATCCGAGCCGGAGGTCCTGGC
CCTTAAACATCGTCATTAAAATCAATTCTGCGAATGGTAAACCCGCAGTG
AAGATCAGCGATAATATCTCGAAGAATACTGGCGACCAGGCGACTGGTTG
AGAAAGTCAAACAAGAGTTGGGATATGTCGAGAAGGAGTGGGAAGATGGT
AACGAGCAGAACCGCTGGAGAACTAGGATCTAATGAGGGTTGAGTTTCTA
TCTGAGACGATTAGATCCGATGGATTCCCTGGGTGTTCAGTTTCATTTTG
TTTGCCGCTCTTCCTAGAGTCATGCAATCGGTCTTCATAACAT

Sequences in the Contig:

SY0AAB58YB15FM1