Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB58YB11FM1
Length(NT) : 649
Best Gene Model Blast : Link to GSTUMT00007342001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein NEMVEDRAFT_v1g155763
Accession: ref|XP_001618098.1| Score: 171 E_value: 8e-11
KEGG Definition: hypothetical protein
Accession: mgr:MGG_00987 Score: 171 E_value: 4e-11
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB58YB11FM1
TTGGGGCAGGCGTGGAGGTCAGTGACGAAGCCTTGGGAGTGATCCCGGGT
TGAACGGCCTCTAGTGCAGATCTTGGTGGTAGTAGCAAATACTCAAATGA
GAACTTTGAGGACTGAAGTGGGGAAAGGTTCCATGTGAACAGCAGTTGGA
CATGGGTTAGTCGATATCACTGCACGCAGGGAAGCCGGCGACGACGGAAT
TGAAAACAACGTCTTGCTACCCGAAGATCTTGTCAAAGAGAAAACCGGAC
CAGATATGTCCTCAGCCGTTATTTCCTCGGCTGCCCCCGATTCTACTACT
GCCGTACTTGCGGCCCAGGTCCCTAAGGAGACCAACGGCGACGTTCAGGA
TGCGGCTATTTCCTCCGCCGCACCCGACTCTACTACTGCCGCCTTGGCCG
CTGGAGTCTCTAAGGAGGCTAGAACACCAAGCCTCAAGAATGTTCCTGGT
GGATTCCCACAGACTCCGGCTATCGAAACATCCGACCCTACCTATATGGT
CTCTCCTCAGGAGGATGCCAAAAAGGTCACGCCTAGCGAGCCCGCTCCTA
AGCATGACGATAATTCCGAAGACGTCGGTGGTGGTGTCAAGCTCGATACC
AGGCAGGAGAAGGCCGATACTTCTCCCGAGGCTCCCGCGGTCCCTGAGG

Sequences in the Contig:

SY0AAB58YB11FM1