Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB58YA02FM1
Length(NT) : 536
Best Gene Model Blast : Link to GSTUMT00002444001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_05964
Accession: ref|XP_001242068.1| Score: 249 E_value: 2e-23
KEGG Definition: hypothetical protein
Accession: ani:AN7719.2 Score: 225 E_value: 5e-22
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0835 Score: 224 E_value: 1e-19
PFAM Definition: No Hit Found
Swissprot: Q6GN15|CCNL1_XENLA

Sequence:
>SY0AAB58YA02FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCAACTTTTTTGTACAAAG
TTGTCCCCGGCTGATGGAATTCCGGCTGACTTAGAGACGTCATTGAGATG
GGCGGGAAGCGAGCTTATTCAAGCTGCCGGTATCCTTTTGCGATTGCCGC
AGAAGACAGTTGCTACGGCAATAGTCCTTTTCCAACGCTTCTACCTTCTA
TCCAGCATGCGTTCTTGCGCGATTACCGACTCCTGTCATGCCGTTATATT
CTTATCGTCGAAGCTCACAGAGCATCCGGCGACGCCTCGAGATATTATAA
ATGTGACTACTTATCTACTAAATACTCCATCACCTTCGCCGATCTCCCCT
GCCCCGGCAGCCGGCCAAGGATCGACACCCCCGGAAGAGCACTACGTTAC
AGAGCAGGAATATTACATCAGGAGAACACGCCTACTCAATGTCGAAAAAA
ATCCTTAAAGCCTGTGGATTTCAAACACATCTTTCGTTGCCGTACACCCT
TTGCATAAACTACATCCAGTCACTCTCCGTGCTCTC

Sequences in the Contig:

SY0AAB58YA02FM1