Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB57YM14FM1
Length(NT) : 407
Best Gene Model Blast : Link to GSTUMT00008198001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: peroxisomal membrane anchor protein, putative
Accession: gb|EDP54799.1| Score: 179 E_value: 4e-12
KEGG Definition: peroxisomal membrane anchor protein, putative
Accession: afm:AFUA_2G12970 Score: 176 E_value: 4e-12
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB57YM14FM1
TTGGCAGACCCTAGCGAACTATTCCACGTCGATGCCACGACACAAACAAG
CCCATTACCGGACTACAACCTCAACACCTCCGATGAAGCCGAGGACCTAA
CCCCGGACGGGAAACTGGAACACCTATCAACGCAACTCCACGCCCTCGTC
GAGAGCCACTCAGACGGCATGGACAACGAGCTCACATTCGCGCTCGAGGA
CCTAAGGAGCTACCTCGAGAGCCTCACCTACGACTGGAGCAGTTCCAGCA
TTTTTACCTCGCCCTACGATTACGGTGGGGCGAAGGGCAAGGATGACGCT
GTGTCGAAGGTTAAGGCGGAAATTAGGAGTGTTAAGGGGGTTTTGTTGAA
TACGAAGAATTTCCCGGCGTCGAGGTGATGGGTCGTGGTGTGCAGTAGTG
GTATGAG

Sequences in the Contig:

SY0AAB57YM14FM1