Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB57YM02FM1
Length(NT) : 485
Best Gene Model Blast : Link to GSTUMT00007945001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: Snf1 kinase complex beta-subunit Gal83, putative
Accession: ref|XP_001270106.1| Score: 223 E_value: 1e-17
KEGG Definition: protein involved in Snf1 protein kinase complex assembly
Accession: aor:AO090701000098 Score: 223 E_value: 1e-17
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG1616 Score: 177 E_value: 3e-14
PFAM Definition: AMPKBI, 5'-AMP-activated protein kinase, beta subunit, complex-interacting region. This region is found in the beta subunit of the 5'-AMP-activated protein kinase complex, and its yeast homologues Sip1, Sip2 and Gal83, which are found in the SNF1 kinase complex. This region is sufficient for interaction of this subunit with the kinase complex, but is not solely responsible for the interaction, and the interaction partner is not known. The isoamylase N-terminal domain (pfam02922) is sometimes found in proteins belonging to this family..
Pfam Number: pfam04739 Score: 202 E_value: 3e-17
Swissprot: Q04739|GAL83_YEAST
Gene Ontology:
GO:0031588 = Cellular component: AMP-activated protein kinase complex
GO:0005737 = Cellular component: cytoplasm
GO:0005641 = Cellular component: nuclear envelope lumen
GO:0005515 = Molecular function: protein binding
GO:0007155 = Biological process: cell adhesion
GO:0001403 = Biological process: invasive growth in response to glucose limitation
GO:0006468 = Biological process: protein amino acid phosphorylation
GO:0043254 = Biological process: regulation of protein complex assembly
GO:0007165 = Biological process: signal transduction

Sequence:
>SY0AAB57YM02FM1
TTGGGGGGACAACTTTGTACAAAAAAGTTGGGTCACAGGATTGGGAATGA
AGATGGGGATATTCCGGCGCCGCCCAGCCTACCGATGATGTTACAGAAGG
TTATCCTGAATACGAGTTCTGCAATGAAGGGTGACGCGAGTGTGCTCGGG
ATACCGAATCATGTGGTTTTGAACCACTTGGCTACCAGTTCTATCAAGAA
TCAGGTTTTGGCGGTTAGCGCTACCACGCGATATCGGAAGAAGGCATTCC
CCCTGTCCCTTTCCTCCGCCAAATTTTTTCTTCTCTATTATTTAGCAGAA
TCTAATTTTTCCCTTTTCCCCTTTGATAGTACGTTACGACGATACTGTAT
AAATCAACAACGGAATGATAATGGTGACGGAGGCTGTATTTTTATTATTT
TTTAGCTTTCTTTCTTTCTTTTTTTTTTTTCTTCCTTAGTTCTTAAAATG
GCTACACTGTACTGTACGGGAAAGTGAACGACCGG

Sequences in the Contig:

SY0AAB57YM02FM1