Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB57YG20FM1
Length(NT) : 623
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein An15g06750
Accession: ref|XP_001397203.1| Score: 182 E_value: 4e-12
KEGG Definition: hypothetical protein
Accession: ang:An15g06750 Score: 182 E_value: 2e-12
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB57YG20FM1
TTGGCTCTTTTACTCAACATGAAGACCAATATCCAACATTAGATGGATCC
GGCAGCATATCGAACCTCAGCTAATATGGGTAACAATAGCCGAAACTATG
GCGATCCCTCAAGCAGTAACACACATTTTGACTGCGACGAACGGGGCCAG
ATTCTGGAGTGGTTGTCACCGTTGGCGCCCGGAGGAAGGCATCCAGTTAT
AAGCGTCGACCGAGTGGATGGAGTAGGAGATTGGTGTCTTTGCACAAAAG
AGTTTATGGAATGGCATAAAAACGAAGATCAGACCGTTAACCGTGTTTTA
TTCCTTCCCGGAGAGCCGGGGGTTGGAAAAACCTACCTTTGTTCTCTTGT
GATAGACACACTGTGTGATCAGATTGAAGAAGAAGAGGTCGTCGCCTATG
TGTACTACGACTACCCTGCCTATGAGGAGCAATCTGCGACTAGTGTACTT
GGGTCTGTGATAAGGCAGGTTGTCGGGCGACTGGAACACGTTCCGGAGGA
GATAAAGAATGCCTTTGAGCGGGCGAGAAAACAGGTTAGCCATCGCAAGC
CTCGGCTTCCCGAACTCTGTGAGATGCTTGTCAAGACTCTGTTGTCCTTG
AAAAGGAGCTTTATATGTGTCGA

Sequences in the Contig:

SY0AAB57YG20FM1