Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB57YF13FM1
Length(NT) : 399
Best Gene Model Blast : Link to GSTUMT00000793001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_09584
Accession: ref|XP_001589862.1| Score: 460 E_value: 1e-44
KEGG Definition: WD repeat protein
Accession: afm:AFUA_5G11870 Score: 441 E_value: 8e-43
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG0308 Score: 276 E_value: 7e-26
PFAM Definition: No Hit Found
Swissprot: Q09731|YA4E_SCHPO
Gene Ontology:
GO:0000935 = Cellular component: barrier septum
GO:0051285 = Cellular component: cell cortex of cell tip
GO:0005829 = Cellular component: cytosol

Sequence:
>SY0AAB57YF13FM1
TTGGGGGGACAACTTTGTACAAAAAAGTTGGGGGGACAACTTTGTACAAA
AAAGTTGGGAAACTATTCTCGACGCTGATCCCGGGGTCCTGGTTCCCGTT
AATGATCTTCCTGACGAAACTATTGAGGGGCAACATGGTCTAATAAAGCA
CTTTTTACTAAATGATAGAAGGAGGGTCTTAACCTTAGACACGGCGGGTG
AGGTGATGATGTGGGATCTACTAAAATGCATGCCAGTCAAATCCTTTGGC
AAAAGGCATCTCGAAGACGTTGCGGCCGAGGTAAACACTGTTGAGAGCGT
GGCGAACTGGTGCCAAATAGATACTCGAACAGGCCGACTAGCCTGTGTCT
TGGAAGAGAATTACTGTTTCGATGCTGAGATGTACGCCGATGAGGCCGA

Sequences in the Contig:

SY0AAB57YF13FM1