Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB57YF07FM1
Length(NT) : 636
Best Gene Model Blast : Link to GSTUMT00010824001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001537314.1| Score: 168 E_value: 2e-10
KEGG Definition: hypothetical protein
Accession: ani:AN8505.2 Score: 153 E_value: 5e-09
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB57YF07FM1
TTGGGGGGACAACTTTGTACAAAAAAGTTGGACACGCCCTCCTTTTCCTA
GAGGAAGTCCGAATATAATTTTTATAAAAGACTCTTGAGTTTTCATTTGG
TGTCACTCCCAAGTCACAGCTTACCAGTACTTATCACGCACGTGATCATG
GAGGGACTCTCATTAGCTTCCAATATCATAGCGGTGCTCACGCTCGCCGG
CAAACTCCTTACCACAGGATACCAATATGGCTCCAGCTCCGCTCAATCCC
CACCCGAACTCCGACGCCTGGTACGAGAAGTCACGACACTCAGTGGCGTC
CTGCACGCTGTAAACAGGCTAGTCGGCGACCCTGTTGCCAGTCCGAGAAC
CGATAATGGGAGTTCTGGAAATCTCATAAGAAATATGGCCGAGCCCGTCG
AGCAGTGCCGGAAGTTGATGGAGGGGATGTTGAGGGATTTACAGAAGTAC
GATGCGTCGAGTAGGAGGCGGGGCGCCTGGAGGCTTTGCTGGCCATTGAA
GGAGAAGACGACGAAAGAGTGGTGTGAGCGACTGGAGAGGTATAAGTCGT
CGTTTGAGGTTGCTTTGTCCGTGGATGAGGTGTCGTTAGCATGGGAGATT
CGAAACGATGTAGAGGATATTAAGGCAATTCAACTC

Sequences in the Contig:

SY0AAB57YF07FM1