Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB57YE20FM1
Length(NT) : 640
Best Gene Model Blast : Link to GSTUMT00006809001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_12067
Accession: ref|XP_001549090.1| Score: 571 E_value: 3e-57
KEGG Definition: metallopeptidase Mip1 [EC:3.4.24.59]; K01410 mitochondrial intermediate peptidase
Accession: afm:AFUA_6G08640 Score: 527 E_value: 2e-52
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG2090 Score: 510 E_value: 1e-52
PFAM Definition: Peptidase_M3, Peptidase family M3. This is the Thimet oligopeptidase family, large family of mammalian and bacterial oligopeptidases that cleave medium sized peptides. The group also contains mitochondrial intermediate peptidase which is encoded by nuclear DNA but functions within the mitochondria to remove the leader sequence..
Pfam Number: pfam01432 Score: 406 E_value: 1e-40
Swissprot: P37932|PMIP_SCHCO
Gene Ontology:
GO:0005759 = Cellular component: mitochondrial matrix
GO:0004243 = Molecular function: mitochondrial intermediate peptidase activity

Sequence:
>SY0AAB57YE20FM1
TTGGCGTGGGCTCACAAACACGGGGACCGTAACGCTGCCGACTACTGGGA
TGCCGGCGAGTCATGCTTTGAGAATGGTGGAGGATGAGGATGTTAGGAAG
GAGGTGTACCTTGCTTGCCATACCAGTTCCAAGAAGCAGTTGGGGGTTTT
GGAGGAGATGTTGAGGACCAGGGCGGAGTTGGCACGGCTGGTTGGACGCG
AATCTTATGCGGAGGTAGCGCTTGCAGATAAAATGGCTCGGTCGCCGGAA
GCTGTCTTGAAGTTTTTAAATGCGCTCTCAGAGGCTAATAAGCCCGCTGC
TATATCGGAGGAAAGTATCCTACAGAGTATCAAGAGGGAACTGGGGAACG
ACACCCCATTACAAGCTTGGGATAAGGACTACTACTTCGCGAAGTTAATC
CGGGCAATCCGCTCTCACCGCCGCTCACCTGACATTCTCTCCTCCTACTT
CTCCCTAGGAACTGTGATGCAAGGCCTCTCGAGGCTCCTAACAAGGCTCT
ACGGCGTCCGCTTCGTCCCCCGCGAAACCTCCCCGGGCGAGACCTGGAAC
GACGACGTCCGGCGCCTGGATATTCTTGACGAATCCGACGGGCACATCGC
AGTAGTCTACTGTGACCTCTTTGAGCGCCAGGGAAAGCAC

Sequences in the Contig:

SY0AAB57YE20FM1