Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB57YB20FM1
Length(NT) : 521
Best Gene Model Blast : Link to GSTUMT00005397001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_02086
Accession: ref|XP_001559422.1| Score: 239 E_value: 6e-19
KEGG Definition: 60S ribosomal subunit biogenesis protein Nop16, putative
Accession: afm:AFUA_2G01480 Score: 216 E_value: 1e-16
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG4771 Score: 220 E_value: 4e-19
PFAM Definition: Nop16, Ribosome biogenesis protein Nop16. Nop16 is a protein involved in ribosome biogenesis..
Pfam Number: pfam09420 Score: 189 E_value: 1e-15
Swissprot: A6RNR4|NOP16_BOTFB

Sequence:
>SY0AAB57YB20FM1
TTGGCCTTCATCTATTTACCACCACAAACAATTCCGAACACCCCCCCGCC
TCCACAAAAATGGGCCGCCAACTCCAAAAGAAGAAAAACAGAAGCTCAAT
ACCGAAGCAATCCAAGCACAAAAACCCTCGCATCTTCAAGGTCCATCCAA
CCGGGAACGCCCTCATAGCTGCAAACTGGGATCGTAAGCAAACGCTCTCG
CAGAATTACCGAAGATTGGGATTAGTTTCTAGGCTGGGGAAGGCTACTGG
GGGTGTTGAGAAGGGTTTCGCTTCTTCTGCTGCTGCCCAGCAGCAGCAGA
AGGAAAGGGTGAAGAAGCTGGCGCCCGGCGAAGCGCGTATCGTCCGTGAT
GAGGAGGGGAATGTTATTCAAGTCATTTACGGCAAGTCTGCTGAGGAGGC
GCTGGACTCCGACTCTGAAGAGTTCACGGGGTGTGCTGGAGGGGGTGGTG
AAGAAATGGATTTTGTCAAAAAGTTGGAAGCCCAGGCTACCGTCGGCGAG
AGGAAGAGTAGGAAGATTTTG

Sequences in the Contig:

SY0AAB57YB20FM1