Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB57YA19FM1
Length(NT) : 554
Best Gene Model Blast : Link to GSTUMT00003504001 E-value : 1e-129
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001210207.1| Score: 387 E_value: 5e-36
KEGG Definition: hypothetical protein
Accession: ang:An16g07795 Score: 347 E_value: 1e-31
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB57YA19FM1
TTGGCATAGCGACATGCGAATACAGCAAGAAGGGATTTGCAAGGAAATAC
GATTGTCAACGCCATACATTGACCCACTACAAAGGCACCATGGTCTGTGG
CTTTTGCCCGGGCAGTGGATCAGCAGCAGAGAAGTCCTTCAACAGAGCCG
ACGTATTCAAGCGCCATTTGATGTCGGTCCACAATGTAGAGCAGACCCCA
CCCAACTCTCGTAAGCGTCCTCCAACAAAGACATCAAACCCCGCAGACCC
CACCTCCTCTGATAGTGAAGACGAGGATGAGGATGAGAAAGACACAACCT
TCAATCCGGCAACCAACAAATCAGCCGCCAAGATCCGCATAAAAAAGGGA
ACTATCAAGCACTCCGGCTCCGGCGCCGGGAGCACGCAGAGGTGACAATC
AGCCCACTCCCGCCCACGAGCCGGGAGTGCCAAAACAAAGACCATTCGCC
GCAAGCGCAAGAATTTTCCGGCAGGGTGGGGATGTCAGCCTGAGCAGATG
GTCACGAAGAGACGCTGCCTGATGGTATTCGATGGACCAAAGTTACTCTG
CAGA

Sequences in the Contig:

SY0AAB57YA19FM1