Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB56YN06FM1
Length(NT) : 525
Best Gene Model Blast : Link to GSTUMT00006282001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_12619
Accession: ref|XP_001586632.1| Score: 377 E_value: 6e-35
KEGG Definition: hypothetical protein
Accession: mgr:MGG_00140 Score: 331 E_value: 7e-30
KOG Definition: No Hit Found
PFAM Definition: DUF1183, Protein of unknown function (DUF1183). This family consists of several eukaryotic proteins of around 360 residues in length. The function of this family is unknown..
Pfam Number: pfam06682 Score: 221 E_value: 3e-19
Swissprot: Q6AYN2|TMM66_RAT

Sequence:
>SY0AAB56YN06FM1
TTGGCCCAAATGAAGCTCCCCACCGTTACCATTTTTCTGCTAGCCACCTC
GGCGGCAGCAGCAAAGCTAAAATCCGGTCAAAAAATACTCCTCTCCGAGG
TTCCCGCCTTAACGCTGCGAAGCGACCAGATGACAAAGAATCGGAGAGTC
CCAGCAGTTCCGCAGGTAAGGAAGCTGTGGGAATCCTCATTGAATATTGG
AAGTGATTACAATGACGAGTACGTGAGCTGGTCATGCACTGCTGATCTAC
CGCGAGAGTTCAAACTTGGCTCTACCGACGTTATATGCGAGGGCTATGAT
AGCGCTGACGACCAATACGTCCTCAAAGGTTCCTGTGGAGTAGAGTACCG
GCTGGCACTCACAGATTACGGATACGAAAAGTTCGGATACGGTGGGTCGG
TATTCAAACGATTACCGTCGAAGGGCATAGAGGCAGAAACTTTCCTCTTC
TGGACATTCTTCTTCGGAATCGTCGGATGGATCCTGTACTCCGTGTATAA
AAACCGCAACAATTCAATACCGAGA

Sequences in the Contig:

SY0AAB56YN06FM1