Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB56YM09FM1
Length(NT) : 610
Best Gene Model Blast : Link to GSTUMT00000853001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_04245
Accession: ref|XP_001794664.1| Score: 404 E_value: 7e-38
KEGG Definition: conserved hypothetical protein
Accession: fgr:FG01217.1 Score: 381 E_value: 2e-35
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0370 Score: 199 E_value: 1e-16
PFAM Definition: No Hit Found
Swissprot: P03965|CARB_YEAST
Gene Ontology:
GO:0004088 = Molecular function: carbamoyl-phosphate synthase (glutamine-hydrolyzing) activity
GO:0006526 = Biological process: arginine biosynthetic process

Sequence:
>SY0AAB56YM09FM1
TTGGCCCACTGTGAAAGCGCACCTAGAAGAAGCAGGAGTCAGTGTCGAAC
TCATCGAATTCCCGAAAACGGACAAGAGGAAGCTTAGGGAGGTGTTCCAG
AAGTATGACATCTCGGGCGTTTTCAATCTGGCAAACGCGAAGGCGAAGTC
GTTGGTTGACGAGGACTATGTCATGAGGAGGAATGCTGTGGATTTCAATG
TTCCGTTGTTTATGGAGCCTAAGACCGCCGTGCTCTTCGCCCAATGCCTT
AGTGAAAAGCTACCACTTGAGAGAGAGAAGATTCCCGGAGAGGTTAAGAG
GTGGTCGGAGTTCATTGGCGGGAAGCCGTTATAGGGTTGTAATTTGTAGT
ATTATGGGCGACGAACAAAGATAATTTTACTTTTTTGCCTTTAACATTTT
TTCTCCCTTCTCGTGCGGTAGTTTATTTTGCTCCTCCTCTCTTTGGTCGT
GGTTTTTGGGCGATGTTTGGACAAAAAAAAAGGGTTATTCTTGGTGTGAT
TTAATTCGATTAGTTTATTGAGGTGATTTTGGCTGGAACCGGGCGGAAGG
AAAGGTAGGGTGGGTGGATGGATGGATGAATGGGTGTTGTATATATAGGT
CTGGGGGGGC

Sequences in the Contig:

SY0AAB56YM09FM1