Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB56YL18FM1
Length(NT) : 604
Best Gene Model Blast : Link to GSTUMT00001466001 E-value : 1e-150
Numbers of ESTs : 1

Blast Results:

Nr Definition: protein serine/threonine kinase (Ran1), putative
Accession: ref|XP_001271058.1| Score: 380 E_value: 2e-71
KEGG Definition: protein serine/threonine kinase (Ran1), putative [EC:2.7.1.-]; K00924
Accession: afm:AFUA_3G10530 Score: 373 E_value: 2e-71
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG0583 Score: 226 E_value: 9e-20
PFAM Definition: Pkinase, Protein kinase domain..
Pfam Number: pfam00069 Score: 231 E_value: 2e-20
Swissprot: P08092|RAN1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0005515 = Molecular function: protein binding
GO:0004674 = Molecular function: protein serine/threonine kinase activity
GO:0031138 = Biological process: negative regulation of conjugation with cellular fusion
GO:0045835 = Biological process: negative regulation of meiosis
GO:0006468 = Biological process: protein amino acid phosphorylation

Sequence:
>SY0AAB56YL18FM1
TTGGTGACCTTTTTACCAACATCACTGAGCGTGGACAATATGTGGGTAAT
GATCTTTCGGCCAAAAGGGTTTTCCTTCAGCTTTTGGATGCCGTGGAGTA
CTGCCATAATCTTGGGATTTACCATCGGGATCTGAAGCCGGAGAATGTAT
TGGTTTCCAACGGCGGCCTCCAGGTCAAGTTGGCGGATTTTGGACTTGCT
ACTACCGAAACTGTCACCTCGGACTTTGGCTGTGGGTCGACATTCTATAT
GTCACCTGGTAAGATTACAGATTTCTTTTGTTTTTATATTTTTATTTTTA
ATACTTTTAGCGCCCTTTTCAAGCTAATCAAATTCTAGAGTGTCAACAAT
CTTCTCCACGCAATGTTACCTGCTATGCTTCCGCTCCTAATGATGTCTGG
TCCTTGGGCGTGATCCTGGTAAACCTTACTTGTGGCCGGAACCCTTGGAA
AAGGGCCTCCCCTTCAGATAGTACATTCCGTGCCTACTTGAAGGACCCAC
GAATGCTTAGGACCATTCTGCCTTTGTCCCAGGAGCTTGATTCTATTCTT
CGAATGATCTTTGAGTGCAATCCCCAGAAGAGGATTACTATCCCGGAGTT
GCGA

Sequences in the Contig:

SY0AAB56YL18FM1