Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB56YJ21FM1
Length(NT) : 555
Best Gene Model Blast : Link to GSTUMT00010460001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_05373
Accession: ref|XP_001245932.1| Score: 166 E_value: 5e-20
KEGG Definition: hypothetical protein
Accession: ncr:NCU06437.1 Score: 152 E_value: 3e-13
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q96EP1|CHFR_HUMAN
Gene Ontology:
GO:0007093 = Biological process: mitotic cell cycle checkpoint

Sequence:
>SY0AAB56YJ21FM1
TTGGATCCCAAAGGTGTACAAAACCTCATTACATCCTCAGGAAGGAGAAG
ATTTCGGGTTAGGGGCAGATCAAAATCGAATCGAGTCGAATCGGCCGTTA
CTGAAGAAATTCACATTACCGAGAAGGGAACCTTCCGAGTTAAAAGCGAA
TAGGGGATCAAACATCATGAGTTCCTCCGTGATCGAGAAGGAATTGACCT
GCTCAATCTGTACAGACATCCTCTTCGACCCCGTAACCTTTCTCGACTGT
CTCCATGCGAACTGCGGGGCATGCGCGAAATCGTGGTTCGCTTCGCTGAA
CAATTCCGGGTCCTCATCAAATAGGTTCACCTGCCCAGCATGGTCGAGCG
GTAGTAAAGGAGGCGAGAGCGGGCGGCCTGCTGCAGAACCTGGTTGATGA
CTTCGTCAAGAGCGATCCATCAAAGGATCGGACACTAGAAGAGAAGAGGA
AGATGCGGTCATTGTACAAGCCTGGTGATAAAGTGCTTCCGTTAGCCGGG
GGGTCGAGTAGTACGCCGCCAGTGGGAGCGCCAAGACTTCGCAAAACTCA
CCGAC

Sequences in the Contig:

SY0AAB56YJ21FM1