Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB56YJ11FM1
Length(NT) : 478
Best Gene Model Blast : Link to GSTUMT00005335001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001537136.1| Score: 223 E_value: 3e-17
KEGG Definition: transcription initiation factor TFIIIB, Bdp1 subunit
Accession: aor:AO090701000103 Score: 179 E_value: 2e-12
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB56YJ11FM1
TTGGCCCGCAGCTAAAAAATCTCCAAAGGAACCAAGGGAACCCAGCAAGC
CCAACGAAAAGAGGCCTGGCGGCCGCTATCGTGCACCGTCCCCTGAAGAT
GGAGAGCAGCGCGAGATAACTCCATCTGTCATCAAGATGAAGGATCTGTG
TCGAGACATCAGAATTGGCAGAAAGTCTAAACGCTTTATAGAGCTTGAAC
AAATGGACTGGACGAAACCGGCCGGCGATGATAAGGCTGCAAAGACAGCT
CTCGATTTTGAGCAAGCTGCTGGTGAAGAAGTGGAGCAAGAACCAGCGGA
GGAAGGAACTGAACGACTGGCCAATGGGGGGCAAAGTCTTCCAAGAGCCG
GCGCTCCGCAAATGCGAATGGTTAATGGCGAACTTGTTCTTGACCAGGAG
TCCATTCAAGTGAACTCTCACGAGCGCAATCCCATCGACGAGGGGTCTAT
GGAAGTCGTTGAGGAGAACATGGCATTC

Sequences in the Contig:

SY0AAB56YJ11FM1