Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB56YJ09FM1
Length(NT) : 647
Best Gene Model Blast : Link to GSTUMT00003573001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein An15g02000
Accession: ref|XP_001396739.1| Score: 520 E_value: 3e-51
KEGG Definition: hypothetical protein
Accession: ang:An15g02000 Score: 520 E_value: 1e-51
KOG Definition:
Classification: [Coenzyme transport and metabolism].
Kog Number: KOG2900 Score: 558 E_value: 3e-58
PFAM Definition: No Hit Found
Swissprot: O59778|BIOB_SCHPO
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion
GO:0009102 = Biological process: biotin biosynthetic process

Sequence:
>SY0AAB56YJ09FM1
TTGGCCGCCTTGGGGTCCAACATGGGATCGACCGCTACGGTATCGGGAGG
AGAAAGGAACAGATAAAGATTGAACGAGGGCAAGATGAACCATATTCTAC
GTTTTTCGATTGGTCTCGAGAGGATGGGGATAGGGATGCGGAAACGGTTG
CTGGCGACGCATGCCCAAACTCCAGCCAGTGTGGCTATGGGAGATGCAAT
GACGCTGTTGGAGAGAGTAGTCAGCGCGCCGCCAAAGAATACCTGGACGA
AGGATGAGATCTCTAGTATCTACAATACTCCGTTAATGGAGTTGACGTAC
GCCGCTGCAACATTGCATAGAAAACACCACCCCCACAACACCGTCCAAAC
CTGCACCCTCTTGTCCATAAAAACCGGCGGCTGCACGGAAGACTGCAGTT
ATTGCGCCCAATCCTCCCGCTACTCCACTGGCCTGACCGCGACCAAGCTA
TCCACCCTCGAAACCGTCATGACCGCCGCTCGCGAAGCCAAGGCGAACGG
AAGCACACGTTTCTGCATGGGCGCAGCATGGCGCGACATGTCCGGCCGTA
CGCGCGGGCTAGAGCGCATAAAAGACATGGTCCGCGAGGTCCGAGGCCTA
GGAATGGAAGTGTGTGTGACGCTAGGAATGTTGGACTCAAAGGCGGC

Sequences in the Contig:

SY0AAB56YJ09FM1