Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB56YJ08FM1
Length(NT) : 449
Best Gene Model Blast : Link to GSTUMT00005701001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: glycogenin
Accession: gb|EDP55892.1| Score: 158 E_value: 1e-09
KEGG Definition: glycogenin
Accession: afm:AFUA_1G05580 Score: 158 E_value: 5e-10
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG4462 Score: 104 E_value: 8e-06
PFAM Definition: Extensin_2, Extensin-like region..
Pfam Number: pfam04554 Score: 113 E_value: 6e-07

Sequence:
>SY0AAB56YJ08FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCAACTTTTTTGTACAAAG
TTGTCCCCCAGGTTTCTGATGTTCCAGCTAGACGTTCTGCTCCTCCACCT
TCCTCCCCCCCACGTCAACTGGAGCAACATGCACCACTGGTGACACCATT
CTCTACACCATATTACAACTGGGATCCTACTCGCTCGGCTCCACCAGTCG
ATAGTGCTCCGGAAGCCAATCGTTTCCCCCGTCAGTTCTACTCCAATGAA
TGGGATAACCCTGCGCCGGCATTTAAGACTCCAGTGCCTGCCCCCCCACA
GGGACAGAAGAGATGGTTTGAGAGCCGTGAGAAGACCCCGGAGCCTCAGC
GGGAGCCTCCGCTAAGACAAATTTTCCCATGGGAGAATAAACCAAGGACC
ACTACTCGCGTATTCGCTGATGACCCGCCGGTCGAGGAACATGTTGAGG

Sequences in the Contig:

SY0AAB56YJ08FM1