Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB56YJ04FM1
Length(NT) : 491
Best Gene Model Blast : Link to GSTUMT00008427001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_04226
Accession: ref|XP_001594419.1| Score: 208 E_value: 2e-15
KEGG Definition: DNA mismatch repair protein, putative
Accession: afm:AFUA_8G05820 Score: 202 E_value: 5e-15
KOG Definition: No Hit Found
PFAM Definition: DNA_mis_repair, DNA mismatch repair protein, C-terminal domain. This family represents the C-terminal domain of the mutL/hexB/PMS1 family. This domain has a ribosomal S5 domain 2-like fold..
Pfam Number: pfam01119 Score: 130 E_value: 8e-09

Sequence:
>SY0AAB56YJ04FM1
TTGGGTCGCTACTTGTCAATGGATAAATACCGAGCATGAAGAGGTCACGG
ACGGTTCGGGAGAGCAGAAAATCGGCATAGAAGCCTTTATGCCGAAGCCC
GGTTCAGATCCCGCAATCATATGTAGGAAGCCGCAATGTACGAATTTTGT
TTTTGTGGACAGTCGGCCGGTATCGTGCGCTCGGGGCACTCTGAAGCAAA
TCTTGTCGTTGTATAAATCTTACCTTAAGTCTGCATTACCCGATTCTGCC
ATATCTGATCCTTTCCTCTATCTTAACCTGCGTTGTCCTCCTGGGGCCTA
CGATCCGAATATTGAGCCGGCCAAGGACGACGTCATGTTCTTTCACGCGG
ACCGGGTTATCGGAGCTGTAGAGGTGATTTTCAAGGGCTTATATGGAGAA
CTAAAGACTAAGAGCAGTCCTGGTGGATCTGGAGGGAAGGGGAAGAGCGT
AGAAATGATGACAGGTGGTTTTGAGCTTTTGCTTGCTAGGA

Sequences in the Contig:

SY0AAB56YJ04FM1