Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB56YH11FM1
Length(NT) : 519
Best Gene Model Blast : Link to GSTUMT00004826001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE62814.1| Score: 500 E_value: 3e-49
KEGG Definition: uncharacterized conserved protein, contains WD40 repeats
Accession: aor:AO090120000203 Score: 500 E_value: 2e-49
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG2111 Score: 396 E_value: 1e-39
PFAM Definition: No Hit Found
Swissprot: Q6CEI9|HSV2_YARLI
Gene Ontology:
GO:0030659 = Cellular component: cytoplasmic vesicle membrane
GO:0005774 = Cellular component: vacuolar membrane

Sequence:
>SY0AAB56YH11FM1
TTGGCAAATAGCGACTACCGGCCGACCACAAGCGCTCTCTGCTACTTTCA
ATCAGGATAACTCTTGCTTCTCTATTGGTCTTGATAGCGGGTTTTGCGGT
ATACTCTTCCTGCCAGCCCCCATGCCTGGTCATGACACTTATTGCATGCC
GTAATATTTAGTCTACAATACAGATCCATGCGAGCTTCAGATATCTCGAA
GTCTCGGTGCTGGTATTGGGGTAGCGTCTATGTTGGGCAGAGCTAACTAC
CTTGCTCTTGTTGGTGGGGGTCGCTCTCCGAAATTCCCGCCAAACAAAGT
CATAATATGGGATGATATCAAGCAAAAGGCCGTGATAACTCTTGAGTTCC
GCTCCGAAGTTCATGCTGTGCGTCTGTCACGACAGCGGATAATAGTTGTC
TTAATTGGCACGGTTCATATCTATGCCTTCTCGTCACCCCCTGCTCGAGA
GCATGTCTTCGAAACACATGACAACCCACTAGGGCTGGTCGCACTTTCAT
CAAAGTTCCTGGCGTTTCC

Sequences in the Contig:

SY0AAB56YH11FM1