Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB56YD11FM1
Length(NT) : 638
Best Gene Model Blast : Link to GSTUMT00000492001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein FG01986.1
Accession: ref|XP_382162.1| Score: 426 E_value: 2e-40
KEGG Definition: hypothetical protein
Accession: fgr:FG01986.1 Score: 426 E_value: 1e-40
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG2533 Score: 341 E_value: 4e-33
PFAM Definition: MFS_1, Major Facilitator Superfamily..
Pfam Number: pfam07690 Score: 153 E_value: 3e-11
Swissprot: P53322|TNA1_YEAST
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion
GO:0015663 = Molecular function: nicotinamide mononucleotide transmembrane transporter activity
GO:0015890 = Biological process: nicotinamide mononucleotide transport

Sequence:
>SY0AAB56YD11FM1
TTGGGGGGACAACTTTGTACAAAAAAGTTGGAGGATACAGTACTGACAAT
GGCTCACTTCTACCACTTCAGCTTCCACAGTTCCATCGGGCATCACGGGC
CCAAGCGGACCCCCAAACAAAATTCCGAAGAGAAAGCCCCGAAGGTGACC
GCTCCCGTCACTCCCGAGACGGCTTCGCAAATCCAAGCGCAGCAGACGAC
AAAACGCATCCTCCGCCGAGTCGATCTGCGACTTGTTCCCATCCTTTCGC
TACTCTATCTGCTGTGCTTCCTCTGCCGACAGAACATTGGAAATGCAAAG
ACCTACCATATGACATATGACCTGCACTTGACCACACAGCAGTACCAAAT
TGCATTGACCGCCTTTTTCCTCTCGTACTCCACTTTTGATATTCCATGTA
ATATCATGCTTAAGAAACTTCGGCCGTCCGTGTGGCTGCCTCTTATGACG
CTTTTGAGCGGGGTTATTACTGTTTGCATGGGAGTTGTCAAGAATGCGGA
TGAATTGATTGTTGTGAGAACGTTTCTGGGAATGACCGAATGCGGTTTGT
TCCCCGGTGTGGCGTACGTGATAACGATGTGGTATTGCAAGAAAGAAGCG
CAATTCCGACAGGCGCTATTCTTCTGCGCGGCCAGTAT

Sequences in the Contig:

SY0AAB56YD11FM1