Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB55YP08FM1
Length(NT) : 636
Best Gene Model Blast : Link to GSTUMT00007043001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: PREDICTED: similar to ankyrin 2,3/unc44
Accession: ref|XP_001191069.1| Score: 190 E_value: 5e-13
KEGG Definition: LOC761191; similar to ankyrin 2,3/unc44
Accession: spu:761191 Score: 190 E_value: 2e-13
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0508 Score: 172 E_value: 2e-13
PFAM Definition: No Hit Found
Swissprot: Q9TXQ1|PME5_CAEEL

Sequence:
>SY0AAB55YP08FM1
TTGGGATCGAAATTTCTCGAGTTACCGAACGAGTTGATACTCGCGATCGC
GGAGCTTCTCCCAGTGCCAAGTATTTCCGCGTTGTCACAGTGCAACCGCC
GGTTCGCGACACTCCTCGAATTGACCCTCTACCGAGCCGCAGTGAAGCAT
TCCGGATACGGCAAGTCCATGTTCTGCCGATGCATCGAAACAGGGAACAC
TCGCTCCACCCTCCGCATGTTAGAATTAGGCGCGGACGTCAACTTGGTTA
CCCGCACAGGTGACGGGAGGACACCCCTGCACTACGCGGTCGGAAGCAAG
AACCCAAGCATCGTGAAAGCGATTCTCGAGAAGCCGGGAGTGAAGCTGGA
CGTCGTAGACACGAGCCAGATGCCCTCCACGCCATTAAGTCTGGCTGTGG
GCCAAAGCCACGAGGAAATTGTGAAGCAGCTACTCGATGCGGGTGCTGAC
CCGCGCAAATACCCTGTGGCAAGGGAATGCTACGAGGGTGTTAACCGTGG
AATACTCGGCATCATACGTTCGCTCATCAGCCACGGCCTTAGTGTCGACT
ATGCTGAGAACACTGGGAACACGTTCCTGCATTCCGCTGCGACCTACGGC
AACCTCGACGCCGTGCGCATGCTGCTATCGTGCGAC

Sequences in the Contig:

SY0AAB55YP08FM1