Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB55YP05FM1
Length(NT) : 592
Best Gene Model Blast : Link to GSTUMT00009800001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_12947
Accession: ref|XP_001548552.1| Score: 670 E_value: 1e-76
KEGG Definition: hypothetical protein
Accession: ang:An07g07760 Score: 663 E_value: 4e-76
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0841 Score: 565 E_value: 4e-59
PFAM Definition: 14-3-3, 14-3-3 protein..
Pfam Number: pfam00244 Score: 643 E_value: 4e-68
Swissprot: Q99002|1433_TRIHA

Sequence:
>SY0AAB55YP05FM1
TTGGATCACACACTTGCCCTTCTAATTCTGAGTTTCTCTATCACCGTCTA
TCTAACAACCTTATCAATACACTTTTCGACTGCAAAGTTTCACTAAAAAA
ATCAGTCAAAATGGGATACGAAGATTCTGTCTACCTTGCCAAGCTCGCCG
AGCAGGCTGAACGTTATGAAGAGATGGTTGAGAATATGAAGAACGTCGCA
TCTGCCGATCAAGAGCTTACTGTCGAGGAGAGAAATCTACTTTCTGTTGC
GTATAAGAATGTCATCGGAGCCCGCAGAGCCTCTTGGAGAATCGTGACCT
CTATCGAGCAGAAGGAGGAGTCGAAAGGCAACGAGTCTCAAGTTGCCCTC
ATCAAGGAATACCGTCAGAAGATTGAAGCCGAGCTTGCAAAGATTTGCGA
AGATATCTTAGAAGTCCTTGATAAACATTTGATCCCCTCTGCTCAATCAG
GAGAGTCGAAGGTCTTCTACCACAAGATGAAGGGTGATTATCACCGCTAC
TTGGCCGAGTTCGCTCTTGGTGACAAGCACCGACCTTGCTCCTACTCACC
CCATTCGCCTTGGGCTGGCCCTCAACTTCTCCGTTTTCTATT

Sequences in the Contig:

SY0AAB55YP05FM1