Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB55YO05FM1
Length(NT) : 347
Best Gene Model Blast : Link to GSTUMT00004107001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein An04g02030
Accession: ref|XP_001401571.1| Score: 287 E_value: 1e-24
KEGG Definition: hypothetical protein
Accession: ang:An04g02030 Score: 287 E_value: 6e-25
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG0335 Score: 114 E_value: 3e-07
PFAM Definition: No Hit Found
Swissprot: A2QI25|DED1_ASPNG

Sequence:
>SY0AAB55YO05FM1
CGGTCCAACTCCCCAAGAGTCGGCTGCTCCTAATTCTCATGGTCGTGACT
GGGCCGCCGCACCATCTTTCGCACCTCGTACTGTTGGTAGTAATTGGGAT
GTCCCCCCCCCTCGCCCTCAACGCTCCTTTGATCCCAACGCATATGGCAA
TCCGGGTAGCGGTGGTAATCGTGGAGGTTCCGGAGATGGTCGTTGGATCG
ATGGCAAACATATCCCTGGACCCCCTAATCCCCGTACTGAGCGTGAGCTC
TTTGGAGTCCCCAATGATCCTACCAAACAAGCTACTGGTATCAATTTCGA
GAAATATGATGATATCCCGGTTGAGGCCTCTGGTCACGATGTTCCAG

Sequences in the Contig:

SY0AAB55YO05FM1