Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB55YN22FM1
Length(NT) : 455
Best Gene Model Blast : Link to GSTUMT00007531001 E-value : 3e-20
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG3375 Score: 122 E_value: 5e-08
PFAM Definition: No Hit Found

Sequence:
>SY0AAB55YN22FM1
TTGGCAAGACTGATCAGGCGAGGGCCGACCTTGCCAGGTTGGCGGTTATT
AGGAAGGAGAGGGAGGAGAAGGCGAGGCAGCGGAAGGCAGAGTTGGAGGA
GAGGAAGGCTGCTGCTGAGGCGAAGGCTGCGGCCAGTGGGAGGAAGAAGT
AGTAGTACTTTTGGGGGTGGAAGATAGGGATGAGGGGTCATTCGGCTTGT
GCTTTCCAAACTTTCTTTTTCTTTTCGTTACTTTTTATTTATTACACTCT
TCTGGTACTGCATCTGCCGTGTAAGTGTGTGGGGTCGGTATACTCCCAGT
GTGTTCCATCATAGATATCTTGGGGGAGTGCGATACCGGTACTCGATCAA
ATAACTCTCATCATGGAGTAGCGGTATCACACCTTACCAAAGCCACCGTC
TTCGCGGGTCGTACTTTGAAACACACAGATGGGCCACCACCACTAATCCC
GCCAA

Sequences in the Contig:

SY0AAB55YN22FM1