Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB55YM13FM1
Length(NT) : 344
Best Gene Model Blast : Link to GSTUMT00004068001 E-value : 8e-60
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein MGG_06258
Accession: ref|XP_369743.2| Score: 194 E_value: 8e-14
KEGG Definition: hypothetical protein
Accession: mgr:MGG_06258 Score: 194 E_value: 4e-14
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB55YM13FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCGCTCAAGACAATGCTTTA
AACGACTTATCAACTAACCCTCACCACCCCCGAAGGTCTAGTATTATCAC
GGCGACACATACCAACGATATGATTTCGTCTTCCCAGAATCACCACCCGT
CATCAGTCCACAGCGATTCCGCCAATATGCCTTCGCCGTCTCGGCATTCT
CCATATGCAGATGACCACCCAGCGTTGAGTGCGGTGACACCTGCACCGCA
GCGCCAACACCCCCGCCTCGCCCCTCCTTCCACCGGACAACTCCCGTCGT
CCTACCTTCCAACCTCCTCTCCAGCCCCGTTCTGGAAATATGTC

Sequences in the Contig:

SY0AAB55YM13FM1