Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB55YL13FM1
Length(NT) : 487
Best Gene Model Blast : Link to GSTUMT00000869001 E-value : 1e-114
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE57017.1| Score: 183 E_value: 6e-17
KEGG Definition: predicted protein
Accession: aor:AO090001000507 Score: 183 E_value: 3e-17
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB55YL13FM1
TTGGGGCCAATAGCCCATCCTCCACTATGGAATCCTCAGTTGCGAATACA
CCACCCTCAGCATGGGATGTTGAAGAAGTCGATTACAAGACCCTCATGGA
GGATGAGATAGTGATAGCAGTGATGGGTGTCACGGGCGCTGGGAAGAGCC
ACCTTATACGGCAAGTCACAGGACGCAACGAAATTGCCGTCGGGGACGGT
TTAGAATCTTGTATTCCACCCGTTTCCCTCCCTTCCCTCCCAATCCATCC
GGCACCGGAAACAAGTATATACTAAGAAGGGGTGGTTGTAAGGCACCGAC
AAAATAGCTTCCTACCGATTCAAACACGACGGTCTAAACATCACCCTCGT
CGACACCCCGGGATTCAACGATACCTACCGCACGGACACGGATGTCCTCC
TCGATATAGCAACATGGATGGAATTCAGCTACCGGGAGAACTTCAAACTC
TCGGGAATAATCTACCTACACCCCATATCCGCCGTTA

Sequences in the Contig:

SY0AAB55YL13FM1