Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB55YL05FM1
Length(NT) : 535
Best Gene Model Blast : Link to GSTUMT00006536001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein AN2936.2
Accession: ref|XP_660540.1| Score: 860 E_value: 6e-91
KEGG Definition: hypothetical protein [EC:3.2.1.24]; K01191 alpha-mannosidase
Accession: ani:AN2936.2 Score: 860 E_value: 3e-91
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG4342 Score: 795 E_value: 8e-86
PFAM Definition: Glyco_hydro_38, Glycosyl hydrolases family 38 N-terminal domain. Glycosyl hydrolases are key enzymes of carbohydrate metabolism..
Pfam Number: pfam01074 Score: 698 E_value: 1e-74
Swissprot: P22855|MAN1_YEAST
Gene Ontology:
GO:0005774 = Cellular component: vacuolar membrane
GO:0005515 = Molecular function: protein binding
GO:0009313 = Biological process: oligosaccharide catabolic process

Sequence:
>SY0AAB55YL05FM1
TTGGTCTTGAGCCAATTGTGTATGGAATTGGACATTGTCATATCGATACT
TGCTGGCTCTGGCCGTTTGATGAGACGAAACGCAAGGTGGCGCGCTCATG
GTCCTCTCAGTGCAATCTCCTGGACAGGTATCCGGAGCATAGATTCACCG
CTTCCTCTGCGCAGCAGTACAAGTGGCTTGAGCAGTACTATCCCAAGCTC
TTTGAGAGAGTTCGCAATCATGTCAAGAAAGGCACGTTTCAGTATATTGG
TGGAAGTTGGGTCGAGCATGACACAAATATGCCGAGTGGGGAGAGTTTGG
TGAGACAGTTTATCCTTGGACAACGCTACTTCCAGAGCAGATTCGGGGAG
AGGTGTACCACCTTTTGGCTGCCTGACACCTTTGGATATAGTGCGCAATT
GCCGCAGCTGTGCAGACTTGCGGGAATGACTAGGTTCTTGACGCAGAAGC
TTTCATGGAATAATATCAACAAGTTCCCACACACAACTTTCAACTGGATT
GCCCTTGATGGGTCTCAGGTCCTGTGTCACATGCC

Sequences in the Contig:

SY0AAB55YL05FM1