Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB55YL04FM1
Length(NT) : 667
Best Gene Model Blast : Link to GSTUMT00012297001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_08359
Accession: ref|XP_001798677.1| Score: 234 E_value: 4e-18
KEGG Definition: hypothetical protein
Accession: ncr:NCU07871.1 Score: 185 E_value: 1e-12
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB55YL04FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCGGTGGGGTGCCGGGAAG
CTGTGGGTTGATGAGGAATTGGCCTGCACAATGGGACGGGTGCTCTTATC
GGGAACGAAACTAGAGCACTGGAAGGAAGTCTTTAAGATCATCGAACAGG
TCTTCGGCATCAAGGATCCCATTTCCGAAGAACAGGAGGATGTAAACCCC
GAGGACCGGTTATATGTCGAGGGAACAACAAAGCCCATCAACGAGATCAA
AGAGCTTCAGCAGACACCAATCGGGGGAGATCCAAATGTGCGAGTCCCCT
ACGTCCCGCATCCCCTCCGTGGACAAACGACGCGTGAAAATCCCAGCTCC
GGGTCCAACTCCCCCGCTACACGACCAATGCCCGGTAACAATGTCCTCAG
CTTGGCTATCAAGACATGTACACTGCTATCAGATAAGGAGCTAGCCAGGT
ACTACTGGAAAACCCTGACAGCGCCTCCGTACTCCGTGCGACCGGACTTG
GGAAGCTTCCACGACCTTCTTCGCCTACTGCGAGAGTCACGCTCGGGCCC
GGAAGCCCTGGATGTCCTCCAGGCCATGTTATCCCACCGCGACACAACCC
CGACAGCCAAGTCTTTCTTCATCGCCATGTCTTGCTGCAAGCGCCAAGGA
CGCGGTCCCAGCTTCCC

Sequences in the Contig:

SY0AAB55YL04FM1