Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB55YL01FM1
Length(NT) : 630
Best Gene Model Blast : Link to GSTUMT00009074001 E-value : 3e-88
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001213586.1| Score: 221 E_value: 8e-28
KEGG Definition: hypothetical protein
Accession: ang:An16g05450 Score: 216 E_value: 2e-27
KOG Definition:
Classification: [Cell cycle control, cell division, chromosome partitioning].
Kog Number: KOG3772 Score: 144 E_value: 3e-10
PFAM Definition: No Hit Found
Swissprot: P42937|YG4E_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0005634 = Cellular component: nucleus
GO:0004725 = Molecular function: protein tyrosine phosphatase activity

Sequence:
>SY0AAB55YL01FM1
TTGGCAAAAAGAAAGAGAAAAAACCCACATCTATATTACAGAATCGCACA
ACACAACTCCAACCGCACTCAATCGATCAATCAATAGCCAAATACACCAC
AACCGTACATACATACACATATACAATACACCATGTCGGGTGTGACAATA
TCCGCTCTAAACCGCATTTCCCGCGAACGTCTAAGCAGTCTGCTACTGAC
CCAGCAGCCCAGCGAGGAGGAGGAAGAGAAAGTGGTAGTAGTAGACGTCC
GGGATTCAGACCACATCGGCGGCCACATAAAGTCTTCCCGCCACGTACCT
TCCGAAAGCCTAGACTACACCGCGGCAGAGCTGGCCCGGCAACTGAAGGA
CGCGGAGAAGGTGGTTTTTCACTGCGCATTGTCCCAGCAGCGTGGGCCCA
GCGCTGCGTTGAAGTATCTGAGGGGGAGGGGGTTGTTGGCGGGAGGGAGG
ATCAGGAGGGAAAGGATAGGAAGCAGGAGGTGCTGGTTTTGGATGGGGGA
TTTGTGGAGTGGCAGGCCAAGTACGGTAACGATGAACGCTTGACCGAGAA
TTATAATAAAGAGCTTTGGGAGGCGGAGCATTAAATTATTATTTTTTTAC
TTGTAGAGGTTGAAGCATTGTACGAGCGCG

Sequences in the Contig:

SY0AAB55YL01FM1