Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB55YJ05FM1
Length(NT) : 583
Best Gene Model Blast : Link to GSTUMT00005342001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_05632
Accession: ref|XP_001592711.1| Score: 754 E_value: 2e-78
KEGG Definition: hypothetical protein
Accession: fgr:FG06789.1 Score: 753 E_value: 1e-78
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG2026 Score: 517 E_value: 1e-53
PFAM Definition: UCH, Ubiquitin carboxyl-terminal hydrolase..
Pfam Number: pfam00443 Score: 169 E_value: 3e-13
Swissprot: Q3TIX9|SNUT2_MOUSE

Sequence:
>SY0AAB55YJ05FM1
TTGGCCCACGAGCTTCTTCAGGAAATTTCTCTCCGTTCTTCCAAAAGATT
CACCCTAACCATCCAATCTGACCCAGTGGACTTTCTCTCTTGGTTCATAA
ATAATCTTCACCTTTCACTCGGTGGCTCGAAAACGAAGCCCGGGACTAGT
ATTATACAAAAGGTTTTCCAAGGAAGGCTAAAAGTCGAATCACAGACCAT
TACTGCTAGAGCGGATGCCTCCGATCGATTACGATTTGAGGAGGCGGCTG
AGATTAAGATGGATATTGTAAGGTTTATGATGCTAACATTGGATCTACCG
CCAAAGCCGATCTTCAAGGATGAGCAGGACAAGAATATCATTCCTCAGGT
CCCCTTAACAACCATCCTGTCAAAGTACGACGGCCTACACTCCCAGGAGC
TCCTCGGACAGCGTAAACGCTACCGCCTCCTCTCCCCCCTCCCCCCATTC
TTAATATTCCACATCAAACGTTTTAGCAAGAATAAATTTGTAGAAGAGCG
CAATCCTACTATCGTCACATTCCCCACAAGATCACTAGACATGTCACCCT
ACGTCGAACCTTCAGAGGGCGGTTCCTCGACAG

Sequences in the Contig:

SY0AAB55YJ05FM1