Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB55YF11FM1
Length(NT) : 584
Best Gene Model Blast : Link to GSTUMT00010919001 E-value : 1e-62
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_06210
Accession: ref|XP_001796593.1| Score: 115 E_value: 9e-13
KEGG Definition: GINS complex subunit Psf3, putative
Accession: afm:AFUA_4G11620 Score: 111 E_value: 5e-12
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q0UPV4|PSF3_PHANO

Sequence:
>SY0AAB55YF11FM1
TTGGCCGCACCGAAGACCGCCCGCCTTCAGCTGCAGAGAGGGGGAGAGGA
ACGGAAAAAGGAGGCAAATCTATTTAAAGAAAAACCCCTCTCCCTGGTCA
TCTCAAAACGAAGCATCCACAATCGTCGTTTCACAATGTCATACTACGAT
ATCGATGCTATCCTCACCGATGCCCAAGTATGCTATCTTTTGATACCCCG
ATTATGATAAGCCCTATGAAATGATAGGCGCACAGACAAACAAACAGAAA
GAAAAGCAACTTTTAGCTGACAATTTCAGAAAGTTCCGTGTACCTTCGAG
ATCACGATCCCAGGCCTGGGGTACTTGGAGGGTAATTCAAACATTGATGT
ACATAAACCTACCACCCTCTCCCTCTCCCCTCTTCCCTTCTCCTCACTTC
CGCCTATTTTCCCCTAACGAAAGTGGAAAAATGGAGAAAAAAAAACGCCT
AATTAGCCAAATAGATCAAGCAAGGAACAAGAGTTGAGCTTCCCCTTTGG
CTCGCGGAAATGCTCGGCGTAAGTCAACGCCTAGGCACAGAACAGAATGT
CATATCACTAGACCTTCCACCGGCGTTAGCCCCC

Sequences in the Contig:

SY0AAB55YF11FM1