Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB55YF03FM1
Length(NT) : 451
Best Gene Model Blast : Link to GSTUMT00000289001 E-value : 4e-62
Numbers of ESTs : 1

Blast Results:

Nr Definition: molecular chaperone Hsp70
Accession: ref|XP_001264927.1| Score: 347 E_value: 1e-31
KEGG Definition: molecular chaperone Hsp70; K03283 heat shock 70kDa protein 1/8
Accession: afm:AFUA_1G07440 Score: 347 E_value: 6e-32
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0100 Score: 328 E_value: 8e-32
PFAM Definition: HSP70, Hsp70 protein. Hsp70 chaperones help to fold many proteins. Hsp70 assisted folding involves repeated cycles of substrate binding and release. Hsp70 activity is ATP dependent. Hsp70 proteins are made up of two regions: the amino terminus is the ATPase domain and the carboxyl terminus is the substrate binding region..
Pfam Number: pfam00012 Score: 316 E_value: 2e-30
Swissprot: O93866|HSP70_TRIRU

Sequence:
>SY0AAB55YF03FM1
TTGGGGGGACAACTTTGTACAAAAAAGTTGGCAAAACTTTTTTCACGAAT
CTCTTTATCCTCTGCATTACCTACCTAATCTCTCCTTCATCAACCGAGTT
ATCCATATAACCTTCTCCCAAGATGGCACCCGCTGTTGGTATCGATCTTG
GAACCACCTACTCTTGCGTCGGTGTCTTCAGAGATGACAGAATTGAAATT
ATTGCCAATGACCAGGGCAACCGGACAACCCCATCCTTTGTGAGTATCAC
CTTTCCTAACCGAATTTATCTTCCGAAATTATCTGGACCTTTTTTTCTTG
GAGCGGCTACTAATGGTTTTTCCCCGGTGCAGGTCGCTTTTACTGATACC
GAACGTTTGATTGGCGACTCGGCAAAGAATCAAGTCGCCATGAACCCCCA
CAACACTGTCTTCGACGCTAAACGTTTGATCGGACGCAAGTTCAACGAGC
C

Sequences in the Contig:

SY0AAB55YF03FM1