Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB55YD09FM1
Length(NT) : 668
Best Gene Model Blast : Link to GSTUMT00008722001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein
Accession: ref|XP_505894.1| Score: 505 E_value: 2e-49
KEGG Definition: hypothetical protein
Accession: yli:YALI0F26103g Score: 505 E_value: 8e-50
KOG Definition:
Classification: [Inorganic ion transport and metabolism].
Kog Number: KOG3182 Score: 475 E_value: 1e-48
PFAM Definition: ChaC, ChaC-like protein. The ChaC protein is thought to be associated with the putative ChaA Ca2+/H+ cation transport protein in Escherichia coli. Its function is not known. This family also includes homologues regions from several other bacterial and eukaryotic proteins..
Pfam Number: pfam04752 Score: 438 E_value: 3e-44
Swissprot: Q5SPB6|CHAC1_DANRE

Sequence:
>SY0AAB55YD09FM1
TTGGATTTGCTTCAACTAAGAACACCGAATCCACGTCAGATGAACCATTC
AACTGAATTCTGGTTGTTCGGATATGGAAGCCTCATCTGGAAGCCACCGC
CAGACTATGATCGTCGAGTCCCAGGTTACATTAAAGGCTTCGTGAGGAGG
TTTTGGCAATCTAGTGAGGACCACCGTGGAACGCCGGAGGCACCCGGGCG
AGTAGTTACATTGATCGAGAGATCATACTGGAAGACACTGAACGATCATG
TGAATACAATGGGTCATGAGATGTGCAATCGTATGGCCCAACTTACTAAC
CATTACAAGGACTTTGAGGACGATGACCAGGTATGGGGTATGGCCTTCAG
GATTAAGGCCAATCGAGTAAAAGACGTAATGAGGGAGTTGAACATTCGGG
AAATAAACGGGTATAGCATCCGGAACGACATCGAGGTGTTTTCGTTCTCG
GCGGACGTCCCGCCAATCAAGGCATTAGTTTATATAGGGACACCCGGAAA
CCCGCAATTTGTCGCACGCGAAGGCGTTCCAGGGCTCGACGAACTTGCGC
GCCATATATTCAACTCTCGGGGGCCGTCAGGGGAAAATCGAGATTATTTA
TACAACCTACACAAATCGTTGACAGGTCTTTGCCCAGCAGCCCACGATCA
CCATGTCAGTCGTTTATT

Sequences in the Contig:

SY0AAB55YD09FM1