Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB55YB22FM1
Length(NT) : 725
Best Gene Model Blast : Link to GSTUMT00007929001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Cell wall/membrane/envelope biogenesis].
Kog Number: KOG4701 Score: 117 E_value: 5e-07
PFAM Definition: No Hit Found

Sequence:
>SY0AAB55YB22FM1
TTGGCAGACACACCGCCTAGTTCATTCCTGGTCCAAGAAGGTTCCGGTGC
AGCAACCGAAGGTGTCAAGGTACCGGTTGAAGAACCAGAGAAGCTTAAGA
AAGCACCCGCTAGAAAACGTGGAGCCAAGAAGATGGAAGTTGCAAGTGAG
CCAGCTGAGCCAAAGGTCGAGGCGAACGAGGAGACAACAGTTACCAATGT
CGAAAAGCCTAAGGCGAAGCGGGGGCGTAAACCGGGTCAGAAAGCGGCTA
AGAAGGGTGGGAAGAAGGAACCTGCTGTCAGAGCGGATGCCGGGGAAGAT
ACCTCTATTGAAGAGCGGAATATCGAGGGAGGTAATATCCAGGAAGGTGG
TTTGGAAGAAGTAAACCCAGAGGGAACCGTCGCGGAAAACAACGCCATCT
TGGGAGCCGGTGTTCAAGTGGAAGAGGGTGTGGAGATCAGGATTGAAGAG
GCACCTGCCGATCAAGTATCTGTCGAGGAAACCATCACTAATGCTAACAC
TGATATCGAAGTAACCAAGGTTGGAGAGGCGAATGTCGAAGAGCCGGGAG
CTGACGCAGCAGTGGCCGGGGAAGCTATCGTTGAAAAGAGTGTTGTTAAT
GTTGCCGCCTCTGACGAAACCGCTTCCCGAGAGCTCGCTGTCGAAAGTAC
CACTTTCGATAAGGCACCCGAGATCGAAGTACCTATAGTTGAAGAGGAAG
CCAAGACTGAAGTAGAGGCTGATGA

Sequences in the Contig:

SY0AAB55YB22FM1