Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB55YA19FM1
Length(NT) : 599
Best Gene Model Blast : Link to GSTUMT00006850001 E-value : 1e-172
Numbers of ESTs : 1

Blast Results:

Nr Definition: 30 kDa heat shock protein
Accession: ref|XP_963774.1| Score: 160 E_value: 1e-09
KEGG Definition: 30 KD HEAT SHOCK PROTEIN
Accession: ncr:NCU09364.1 Score: 160 E_value: 6e-10
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: P19752|HSP30_NEUCR

Sequence:
>SY0AAB55YA19FM1
TTGGGGGGACAACTTTGTACAAAAAAGTTGGGGGGACAACTTTGTACAAA
AAAGTTGGAAACAAATTTAAATGCCTGCACCAGTATTTCAATACTTGTTC
TTTCCAGAACTCAACTACTGTCCTTGCCCCCCGAGAAAGTCGTTCTCTCC
CCGCTTCGATGTGCGTGAGACCGCGAATGCGTACATCGTTGAAGGCGAAC
TGCCTGGCATTACCGATAGATCGAATATCTCCGTCGAGTTCACGGGTAGG
GGCAACATGGTTGTCAGAGGGCGGGTTGATCGGTCGAGCACTATAGTCGC
CCCCCAGGCACAACCACAAACATCGTCATCACCATCGCAGCAGACAAGCG
GGAAGGAGGATAAGGGTGAAGATGTGGTCCCAACACCTACTTCCTCCGTG
CCATCATCTCCATGATCACTGAAGCCGACGATCGAAGACGTCCCGGACGA
AGACGATTGGATGGGGATTACTGATTCGTCAACTGAGAAGGCGAGAGTTG
AGGGAGAAGCTGCTAAGATGGGGAGCCCGGTTGAGAGGAAGGAGCAGCCA
AGGGGAAAGGTGGAGAAAGGAGAGGAATGGTCAAAGAGGTTGTTGTCTG

Sequences in the Contig:

SY0AAB55YA19FM1