Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB54YO13FM1
Length(NT) : 652
Best Gene Model Blast : Link to GSTUMT00005263001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001536016.1| Score: 425 E_value: 8e-54
KEGG Definition: predicted protein
Accession: aor:AO090009000608 Score: 400 E_value: 4e-51
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB54YO13FM1
TTGGATTGCTCGTAATGATTGAGGACTCCAACGACGGCATCGTCTCTAGG
GTCAGGGACGACGTGAAGATTCTGGGCGCGGAGAATCATGGCGGGGTCAC
TTGTTATCTGGATACGCTGCTGTTTGCCATGTTTGCCAGGCTGGACGCCT
TTTGAGGCTATGCTATATAATGTGTTTGACGAAGATGACGAGAAGCGAAG
AAAGCTCGCAGCGCTCTTGCGACTGTTTGTGAACCTGCTGCGCTCGGGAC
ATTTGGTTACCACGGATATAATCAGCCAGATACAGCACTCCATTGCGGAG
TGTGGTTGGGAGGAAGCTTCGTCACCTCAGCAGCAAGACCCTTCGGAGGT
TTTTACTTTCATCACCGATACACTTCAGCTGCCCTTGTTGACGGTAAAAG
TTGATATTGCCCACGGGGGCAAGGAGATAGTTGAGGATGACCACAAGTTC
ATATCTGAGAGGCTCTTGAATGTAGCTCTGCCCGATGAAGGTGCTGATCC
TAGAGATCCGATACCTCTAGAGGCCTGTCTTGAAGAATATTTTAACGGAC
GTGTGGACGTTAGGCGTCAACTAGAGCGTAGAGCAACCGCTGATACGGTG
CATTCACACGATGTGGAGAAGGGTTCGGCACTTCATATCGAGACTGTGGA
CT

Sequences in the Contig:

SY0AAB54YO13FM1