Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB54YM20FM1
Length(NT) : 722
Best Gene Model Blast : Link to GSTUMT00002788001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: ubiquitin-conjugating enzyme
Accession: ref|XP_001594560.1| Score: 541 E_value: 1e-53
KEGG Definition: hypothetical protein
Accession: ang:An14g00230 Score: 530 E_value: 1e-52
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0894 Score: 538 E_value: 8e-56
PFAM Definition: UQ_con, Ubiquitin-conjugating enzyme. Proteins destined for proteasome-mediated degradation may be ubiquitinated. Ubiquitination follows conjugation of ubiquitin to a conserved cysteine residue of UBC homologues. TSG101 is one of several UBC homologues that lacks this active site cysteine..
Pfam Number: pfam00179 Score: 287 E_value: 1e-26
Swissprot: P33296|UBC6_YEAST
Gene Ontology:
GO:0005789 = Cellular component: endoplasmic reticulum membrane
GO:0005515 = Molecular function: protein binding
GO:0004842 = Molecular function: ubiquitin-protein ligase activity
GO:0030433 = Biological process: ER-associated protein catabolic process
GO:0006513 = Biological process: protein monoubiquitination
GO:0000209 = Biological process: protein polyubiquitination

Sequence:
>SY0AAB54YM20FM1
TTGGGTGCCGGGAGACACAACACGCCGCACCACGAAGCCCAATCCTACCC
GTCTAACCACACCAAACAGATCTCAGCCGGTGGCGCCAAGACACCCAGCA
ACAGAACCGCAACATCATCAACGCTTCCCTTACCTCACCCACCCTTGCCT
CCAAGTAACAACGCCTTCCCCCATCTCTCGCAATAATCATCCCCCTCCCT
GTATCCAAGTTGGACCGCTCCTCCTTCATCTCCTTGCTCCTTGCTCTAGT
AACCTTAGTTCTTCCTTTTCTCCCACCACGGTCGGCCTCTAGTGAGTGCT
TTGCTAACCCCCGAGATAGGAAGACAGGCAAACAGATAGACAAACAGGCA
AACACCACCATTGGGGATATTCTAAACATGGCCACTCGAGCTGCGAATAA
GCGCCTCGTCCGTGAGTACAAAGCCATCACTGAGAATCCACCGCCATATA
TTCAAGCTCACCCTAGCGAGTCCAACATTCTAGAATGGCACTACATAATA
ACCGGTCCTGAGAAAACACCCTACGAGAATGGCCAGTATTGGGGAACTCT
AGTATTCCCCGCCGATTACCCCTTCAAACCCCCCGCCATCCGAATGATGA
CTCCAAGCGGCCGCTTCCAAACTAGCACACGCCTTTGCCTCTCCATCTCC
GACTTCCACCCCAAATCCTTCAATCCGGCGTGGCAAGTCAGCACAATTCT
AATGGGCCTACTGTCCTTCATG

Sequences in the Contig:

SY0AAB54YM20FM1