Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB54YM15FM1
Length(NT) : 597
Best Gene Model Blast : Link to GSTUMT00001578001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein FG05611.1
Accession: ref|XP_385787.1| Score: 430 E_value: 6e-41
KEGG Definition: hypothetical protein
Accession: fgr:FG05611.1 Score: 430 E_value: 3e-41
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG1379 Score: 278 E_value: 8e-26
PFAM Definition: No Hit Found
Swissprot: Q09189|AZR1_SCHPO
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion
GO:0006470 = Biological process: protein amino acid dephosphorylation

Sequence:
>SY0AAB54YM15FM1
TTGGCCGGCCTTGACCTCCGTTCGTGCTTTCTCCGCCAAGGCTGTTGACC
ATACCGGCTCTTCCCCGGCCTCGCCGGCCTCGAGCACAACTGCAAACGCT
GTCGCCCCCAAAAAATTCACTTACCGGATTTCCGCTGCTTACTCTGCAAA
GCAGGAGAGGTTCAGCCCGGGGACTAATATGTTCCACTATAATCCTTACA
ACAAAGTTCAGGACACTGCCAAGAGAAAGTCCCGTCCGGATGCTGGGCAG
GACGCATTTTTTGTGTCCGGGATAAACGACACCGGAGCTATCGCAACCGG
AGTGGCAGACGGGGTTGGTGGTTACATCGAATCTGGAATCGACTCTGCAG
ACTTCTCGCACACCTTGTGCGAACGCATTGCTACAGCGGCCCACCAGTCT
CCTACGGACAATATCGGTGCGAGGTATTTGATGTCGGTCGGGTACCAAAA
GATACTAGAGGAAGATGTGATTGCAGGCGGAGCATCTACCGCTTGCGTTG
GCGTAGCAAAGGCGGATGGTCGGCTGAACGTCGCAAACCTGGGCGATTCC
GGATTTTTAATCCTTCGACAGGGGAAAATCCACCATGCATCATCCCC

Sequences in the Contig:

SY0AAB54YM15FM1