Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB54YI10FM1
Length(NT) : 464
Best Gene Model Blast : Link to GSTUMT00010526001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_00265
Accession: ref|XP_001246494.1| Score: 453 E_value: 7e-44
KEGG Definition: hypothetical protein [EC:3.6.3.14]; K03661 V-type H+-transporting ATPase 21kDa proteolipid subunit
Accession: ani:AN7603.2 Score: 429 E_value: 2e-41
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG0233 Score: 460 E_value: 4e-47
PFAM Definition: ATP-synt_C, ATP synthase subunit C..
Pfam Number: pfam00137 Score: 132 E_value: 5e-09
Swissprot: P23968|VATO_YEAST
Gene Ontology:
GO:0016021 = Cellular component: integral to membrane
GO:0000220 = Cellular component: vacuolar proton-transporting V-type ATPase, V0 domain
GO:0046961 = Molecular function: hydrogen ion transporting ATPase activity, rotational mechanism
GO:0008553 = Molecular function: hydrogen-exporting ATPase activity, phosphorylative mechanism
GO:0005515 = Molecular function: protein binding
GO:0015991 = Biological process: ATP hydrolysis coupled proton transport
GO:0042493 = Biological process: response to drug
GO:0007035 = Biological process: vacuolar acidification

Sequence:
>SY0AAB54YI10FM1
TTGGTCACTGTCAACACCAACAAGCTCACCTTCCCTTCCTTCTTCTTTTC
TCTTTCCTTCTCACAACCACAGATAACATCATGGGGTACTACTATGGAGG
CGGAACACTGACTACAGCGGTACTCCTCGTCGGAGCTTATATGCTCTTCA
ATGGAGAGGGCGAGACATTCAACATCGGTCGATTTTTGGAGGAAACATCA
CCGTACACTTGGGCCTCACTGGGCGTAGCATTATGTATAGGCCTCAGCGT
CGTTGGTGCAGCACGGGGAATATTCGTAACCGGCTCAAGCATAATCGGTG
GCGGTGTGCGCGCCCCAAGAATCCGCACAAAGAACCTAATTTCCATCATC
TTCTGTGAAGTTGTAGCTATTTACGGCGTAATCATGAGTATTGTCTTCTC
CGCAAAACTAGCAAACGTCCCCGCGGAAGCCCTCTACGACCCGAAAAACT
ACTACACTGGCTAC

Sequences in the Contig:

SY0AAB54YI10FM1