Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB54YG12FM1
Length(NT) : 555
Best Gene Model Blast : Link to GSTUMT00001337001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CHGG_04905
Accession: ref|XP_001224119.1| Score: 309 E_value: 5e-27
KEGG Definition: mitochondrial pyruvate dehydrogenase kinase, putative
Accession: afm:AFUA_2G13600 Score: 292 E_value: 9e-27
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG0787 Score: 198 E_value: 1e-16
PFAM Definition: No Hit Found
Swissprot: Q2KJG8|BCKD_BOVIN
Gene Ontology:
GO:0005947 = Cellular component: mitochondrial alpha-ketoglutarate dehydrogenase complex
GO:0005524 = Molecular function: ATP binding
GO:0004674 = Molecular function: protein serine/threonine kinase activity
GO:0009083 = Biological process: branched chain family amino acid catabolic process
GO:0016310 = Biological process: phosphorylation

Sequence:
>SY0AAB54YG12FM1
TTGGCCTCTCTTCCTCCACACACGCACGCTTCACAGCCAGGGACATGACC
GCCGCGATGTTCCGTGTCGCTGCTGCGAAACCTTTGCAGCGCACGCTGGT
GCGTCGTGTCTCGACCAGCTTTAGTTCACATGGTGGGACTGGGGGTTCCT
TGGAGGGGTATACTCCACCCACGACCAGTCCGGCAAACGATATGATCGCG
CAATTGGCCGCAAAAAATCTTGACAGGTTGAGCTTAAAGGACTTGATTCG
CTTGTTTCTCCCTCCAGCTTCGGCCGTCCTCCACTAACCACCCAATCTCT
CCTTACCTCTGCGCGCTTTACGAGGGAATACCTACCCGTCCGCCTCTCGA
GACGGATCCGAGCCTTGCGAAATCTTCCCTACATTATCGTTTCGAACCCG
AACATTTCAACAATCTACAATAACTACATTGACTCGCTCACCGCCATCCT
TGCCTTTCCCGCGGGGAGCTTGACCAACTTAACCGAGGAGAGCAAGTTCA
CCGAGCTCCTGACGGAAATCGTCAAGACGCACAGCAATACAATTCCCATC
CTAGC

Sequences in the Contig:

SY0AAB54YG12FM1