Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB54YF08FM1
Length(NT) : 606
Best Gene Model Blast : Link to GSTUMT00008777001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001245993.1| Score: 466 E_value: 7e-79
KEGG Definition: conserved hypothetical protein [EC:3.4.25.1]; K02726 20S proteasome subunit alpha 2
Accession: mgr:MGG_07165 Score: 455 E_value: 5e-77
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0181 Score: 424 E_value: 1e-42
PFAM Definition: Proteasome, Proteasome A-type and B-type..
Pfam Number: pfam00227 Score: 285 E_value: 1e-26
Swissprot: Q8X077|PSA2_NEUCR

Sequence:
>SY0AAB54YF08FM1
TTGGCTGATTTCATCCTTCTTGGCTTGTACTTGATACACCCGATATACAT
TAATTATGGCCGATAGATATTCGTTCTCCCTAACTACATTCTCCCCTAGC
GGAAAACTCGTTCAGATTGAATATGCACTCAACGCAGTTAACCAAGGAGT
AACCAGTCTCGGAATCAAAGCTACCAATGGTGTCGTTCTTGCAACCGAAA
AGAAGTCTTCAACGCCTCTTATGAATTCATCCTCCCTTGAGAAGATATCG
TGTATAACACCCAACATTGGGATGATTTACTCGGTGACTACAAGAGAATC
TACAACGAATATCCCCCCACAAGGATACTGGTTCAGGACGTTGCCAAGGT
TATGCAGGAGGCTACCCAGAGTGGCGGTGTGAGGCCCTTCGGTGTTAGTT
TGCTCGTGGCCGGGTGGGACGATAAGCCAGCGGGTACTGGAAAGGGTGGC
CCAGCGCTATACCAGGTTGATCCATCTGGCTCTTATTTCCCATGGAAGGC
GACTGCCATTGGGAAGAGTGCTACTTCTGCGAAAACCTTCCTTGAGAAGC
GATATGCCGAGGGATTAGAGTTGGAAGATGCTATCCACATTGCCCTGTTG
ACCTTA

Sequences in the Contig:

SY0AAB54YF08FM1