Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB54YE13FM1
Length(NT) : 504
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_05389
Accession: ref|XP_001593961.1| Score: 154 E_value: 6e-17
KEGG Definition: hypothetical protein
Accession: ncr:NCU04628.1 Score: 160 E_value: 3e-15
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB54YE13FM1
TTGGTCTTCCAACTGAACTGGGACAAACTCATACTCATACTCGCCATCCA
TGTCTCCAAATTCAGCATTATCCAAAAACGCATAATCCTTGATATGATTC
CCCTCCCGAAAATGCTTCCCTAGATGGTTGAATCGTTCTTCCCAGCCCTC
CAACCCCCGCTTCTTTAACTGCACAACCTCACCCCTCTTCTCAGAGCAGA
AGCCGCACCAGAATGGTACGGAAGTTGTTATTGCCAATGTGCGCTTTGTC
GGTCCATTCCTGAACCCAGGGCTGCTCATCAATGCTGTGCGCTTCCCCCA
AGTGCGTGGCATAAGCCGCTTCGCTATACAAAAGTATACCACAGGCTTTG
GTGGACTCGGGAGTGTTGACGTTGCATTTCCACACTTCCAGTTGAAAATG
CCCAAAGAGCTCGTGACTTTTCCAGTCCGGTTCCGAATCGAATGATTTTC
CACATCCCAGGAAGGTAGAGGCAAATGCAAATGCAGGTTTTCTGACGAGT
ATGC

Sequences in the Contig:

SY0AAB54YE13FM1