Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB54YE07FM1
Length(NT) : 555
Best Gene Model Blast : Link to GSTUMT00007701001 E-value : 1e-162
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_02006
Accession: ref|XP_001559342.1| Score: 108 E_value: 4e-10
KEGG Definition: hypothetical protein
Accession: ncr:NCU03712.1 Score: 111 E_value: 4e-08
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB54YE07FM1
TTGGGCTTAAATTTTTTCACACGCGAGCTTGCTTCCCACTTTCCTCACCC
ACGAACAATTGTTCTGAAACGGCATGTATGGACGGAGAACACATTTCGGA
TTTGGTCCACCAGCTTAACGATGTTGAGCTTGCGGTGCTGTTATCACTGG
TCGCTGGAAAGCACTGTATTCTGACGACAGAGCCAGAATGGCTTGGAGCT
TTTGCGGCAGCAGATTGAGCTAGTGAGTGTTTATCTGAAGTCTTGGGGTT
TTTCTGATGTTTCGGCAGCTCGGGCCAGCCGTATTTGGACTTACGGTGGC
GACCGTTCAGTGCACTCCTGATACCACTCTTGACGATTTTATAGAACCGT
TGCTATTCGACGAAACCCGACCTTCACCCTCCTCACATGGCATATCGCCT
GTGAATAACCGTGAGTCTGGAGAATCCTACTTTGGCACACGAAACCGCTC
AAGCCTTTTACGGACCTCCTCACAGGGTACTCACCACGAGAGCACAAGTG
GTATCCGTAAGCTTGCCAACATTATTATTGCACAGGACCTCGATCTTGCA
AGCAA

Sequences in the Contig:

SY0AAB54YE07FM1