Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB54YD23FM1
Length(NT) : 605
Best Gene Model Blast : Link to GSTUMT00005744001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE57037.1| Score: 214 E_value: 7e-16
KEGG Definition: ankyrin repeat
Accession: aor:AO090001000528 Score: 214 E_value: 4e-16
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB54YD23FM1
TTGGGAAGGCAAGAGCAGAAGAATGTCGCAGGACCCTAGTTTCGTTGCCA
AGTTCCTTCATAATCCTGATTCCTCGGGACGTAATAACCGTCCTAATACC
GATGGCTCCCTAAACAATAATCCTCACTCGGTTGGTAGAAACAACAAGAG
CAGCCTCGACGCGAATAATGGCAATTGTCTTAACGCTTGGAACGACATTA
CCGCCACCTATGACCGGTCCGAAATCCTGGCTTGGTTGTCGCCTCTGGAA
CCCCACTTACGGCATTATGATGTTCAGCGAAGCCGGGTGAGCAACGTGGG
CAACTGGATTTTGCGGACAGAGCAATTCAGAAACTGGTACAGTGGTGATC
GCCGTTCTAAATCGCGGAAGGCGGCCATATTTTGCTCCGGCAACCCGGGG
GTCGGGAAGACTTGCATGAGTTCATTGGTGGTAGATACCTTGTGCAATGG
GGCCGGCGAGGCTGGAGGGGATATTGCGGTGGCATGTTTCTATTTCGACT
ATGCGGCCCAAAAGGAGCAGTTCGCAACGGCTGTATTGGGTGCTCTGCTA
AAACAGGTTGTCGGTGGTTTTAAGCAAATCCCTAAGGAAATCACCGATGA
GTTTC

Sequences in the Contig:

SY0AAB54YD23FM1