Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB54YD19FM1
Length(NT) : 655
Best Gene Model Blast : Link to GSTUMT00003549001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: protein mitochondrial targeting protein (Mas1), putative
Accession: ref|XP_001269657.1| Score: 536 E_value: 4e-53
KEGG Definition: protein mitochondrial targeting protein (Mas1), putative; K09503 DnaJ homolog, subfamily A, member 2
Accession: afm:AFUA_1G05040 Score: 527 E_value: 2e-52
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0712 Score: 426 E_value: 7e-43
PFAM Definition: DnaJ_CXXCXGXG, DnaJ central domain (4 repeats). The central cysteine-rich (CR) domain of DnaJ proteins contains four repeats of the motif CXXCXGXG where X is any amino acid. The isolated cysteine rich domain folds in zinc dependent fashion. Each set of two repeats binds one unit of zinc. Although this domain has been implicated in substrate binding, no evidence of specific interaction between the isolated DNAJ cysteine rich domain and various hydrophobic peptides has been found..
Pfam Number: pfam00684 Score: 260 E_value: 1e-23
Swissprot: O74752|MAS5_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>SY0AAB54YD19FM1
TTGGGTGGAATGGGCGCCGGAATGTCTGCAGAAGATCTGTTTTCCCAGTT
CTTTGGTGGTGGAGGTATGGGCGGCATGGGCGGCATGTTTGGCGGCGGAA
TGCAGCAACAGGGTCCTAAGCGGAGTCGGGATATCGTTCATGTTCACAAA
GTCGCACTCGAAGACCTTTACAAGGGCAAGGTTTCCAAGCTTGCCCTGCA
AAAGAGTGTTCTTTGTTCCAAGTGCGCAGGTCGTGGTGGAAAGGAGGGCT
CTGTCAAAAAGTGTACCGGTTGCGATGGTGTGGGTATGAAGACTATGATG
CGCCAGATGGGTCCTATGATTCAACGGTTCCAGACTGTCTGCTCCGACTG
TAACGGTGAGGGAGAGATGATCAAGGACAAGGATAGGTGTAAAACCTGTC
ACGGGAAGAAGACTATCACCGAGCGAAAAGTTCTGCATGTCCATGTCGAC
AAGGGTATGCAAGATGACCTGTATTACCGCACTGGCTGGCGGAACTATTG
CGGTTGAACATCTTGATGAGCGTTGGTTGACGGTAACTATCAACCCCGGT
GAAGTCGTTAGTCCTGGCGCCATCAAGGTTGTTCGTGGGCAGGGCATGCC
CTCTTATCGTCATCATGATTACGGCAATTTGTACATTCAATTCGATGTCA
AGTTC

Sequences in the Contig:

SY0AAB54YD19FM1